pAAV TBG FFluc miR122sponge
(Plasmid
#35657)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 35657 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV TBG FFluc
- Backbone size w/o insert (bp) 5915
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemiR-122 sponge
-
SpeciesSynthetic
-
Insert Size (bp)156
- Promoter TBG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoR V (destroyed during cloning)
- 3′ cloning site Apa I (not destroyed)
- 5′ sequencing primer tgttgttttggagcacggaaaga (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
Depositor Comments
Please note that there is a 4bp deletion in Addgene's quality control sequence when compared to depositor's reference sequence. This deletion will not affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV TBG FFluc miR122sponge was a gift from Phillip Zamore (Addgene plasmid # 35657 ; http://n2t.net/addgene:35657 ; RRID:Addgene_35657)