pAAV asyn S129D
(Plasmid
#36069)
-
Depositing Labs
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 36069 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV-MCS
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 4581
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namealpha-synuclein S129D
-
SpeciesH. sapiens (human)
-
Insert Size (bp)484
-
MutationS129D
-
Entrez GeneSNCA (a.k.a. NACP, PARK1, PARK4, PD1)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site ClaI (not destroyed)
- 3′ cloning site BglII (not destroyed)
- 5′ sequencing primer bglob fw (TCTTATCTTCCTCCCACAGC)
- 3′ sequencing primer hGH rev (TAGGACAAGGCTGGTGGGCA) (Common Sequencing Primers)
Resource Information
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
Depositor Comments
Lashuel Lab Plasmid #164
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV asyn S129D was a gift from Patrick Aebischer & Hilal Lashuel (Addgene plasmid # 36069 ; http://n2t.net/addgene:36069 ; RRID:Addgene_36069)