1
Plasmid 36292: pDDRFPA1-CaM
  • ddRFPA1-CaM

  • pcDNA3.1+
    (Search Vector Database)

  • Life Technologies

  • Mammalian Expression

  • CMV

  • HindIII

  • No

  • XhoI

  • No

  • TAATACGACTCACTATAGGG List of Sequencing Primers

  • TAGAAGGCACAGTCGAGG

  • Ampicillin

  • DH10B

  • 37

  • High Copy

  • Neomycin

  • View sequences (2)
  • Robert Campbell

  • MTA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: A fluorogenic red fluorescent protein heterodimer. Alford et al (Chem Biol. 2012 Mar 23;19(3):353-60. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 36292" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only