Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at Learn more

(Plasmid #36293)


Item Catalog # Description Quantity Price (USD)
Plasmid 36293 Plasmid sent as bacteria in agar stab 1 $65 Add to Cart
Available to Academic and Nonprofits Only


  • Vector backbone
  • Backbone manufacturer
    Life Technologies
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pM13-DDRFPB1 was a gift from Robert Campbell (Addgene plasmid # 36293)
  • For your References section:

    A fluorogenic red fluorescent protein heterodimer. Alford SC, Abdelfattah AS, Ding Y, Campbell RE. Chem Biol. 2012 Mar 23;19(3):353-60. 10.1016/j.chembiol.2012.01.006 PubMed 22444590