1
Plasmid 36293: pM13-DDRFPB1
  • M13-DDRFP-B1

  • pcDNA3.1+
    (Search Vector Database)

  • Life Technologies

  • Mammalian Expression

  • HindIII

  • No

  • XhoI

  • No

  • TAATACGACTCACTATAGGG List of Sequencing Primers

  • TAGAAGGCACAGTCGAGG

  • Ampicillin

  • DH10B

  • 37

  • High Copy

  • Neomycin

  • View sequences (2)
  • Robert Campbell

  • UBMTA
    Ancillary Agreement for Plasmids Containing FP Materials

Addgene has sequenced a portion of this plasmid for verification. Full plasmid sequence is available only if provided by the depositing laboratory.

Article: A fluorogenic red fluorescent protein heterodimer. Alford et al (Chem Biol. 2012 Mar 23;19(3):353-60. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 36293" in your Materials and Methods section.

Price: US $65

Available to academic and non-profits only