-
Purpose(Empty Backbone)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 37183 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET
- Backbone size (bp) 6025
-
Vector typeBacterial Expression
- Promoter T7
-
Tags
/ Fusion Proteins
- PPL (N terminal on backbone)
- His6 (N terminal on backbone)
- MBP (N terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberLow Copy
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer MBP-F
- 3′ sequencing primer T7-term (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. All 2-series vectors work as single-expression vectors, as well as transfer vectors for our polycistronic system.
2K-T has a TEV-cleavable N-terminal His6 and MBP fusion tag to enhance solubility and ease purification. These tags are preceded by a periplasmic locator signal, which is autocleaved during secretion. The PPL tag may be helpful if your protein binds to or interferes with intracellular E. coli molecules, since your protein of interest is safely sequestered in the periplasm. It may also be helpful if your protein of interest is more stable in the periplasmic environment. Protein purification may also be made simpler using this expression method.
The LIC cloning site is flanked by 5 pairs of restriction sites, so that your gene can easily be subcloned into our polycistronic destination vectors (2D, 2E, or 2Z).
To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET PPL His6 MBP LIC cloning vector (2K-T) was a gift from Scott Gradia (Addgene plasmid # 37183 ; http://n2t.net/addgene:37183 ; RRID:Addgene_37183)