Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #38238)


Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 38238 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 4000
  • Total vector size (bp) 1000
  • Modifications to backbone
    Vector promoter was replaced with genomic mouse Vim promoter (1000 nt of predicted transcriptional start site).
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
    Vim promoter with Actb 5UTR/Renilla
  • Alt name
  • Alt name
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
  • Mutation
    Actb promoter (1000 nt upstream) and 5' UTR was replaced with the Vim promoter and first 30 nt of Actb 5' UTR
  • Entrez Gene
  • Entrez Gene
    Actb (a.k.a. Act, Actx, E430023M04Rik, beta-a, beta-actin)
  • Promoter Endogenous Vim

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Nco1 (not destroyed)
  • 3′ cloning site Nhe1 (not destroyed)
  • 5′ sequencing primer gggctcgctgggtcctaggct
  • 3′ sequencing primer CATCCGTTTCCTTTGTTCTGG
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Depositor Comments

This vector originally contained the mouse Actb 5' UTR followed by the renilla luciferase ORF. In the current version, the promoter and first 30 nt of the 5' UTR have been replaced by the mouse Vim promoter and first 30 nt of the Vim 5' UTR, respectively.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pIS1-Vim/Actb5UTR-renilla was a gift from David Sabatini (Addgene plasmid # 38238 ; ; RRID:Addgene_38238)
  • For your References section:

    A unifying model for mTORC1-mediated regulation of mRNA translation. Thoreen CC, Chantranupong L, Keys HR, Wang T, Gray NS, Sabatini DM. Nature. 2012 May 2;485(7396):109-13. doi: 10.1038/nature11083. 10.1038/nature11083 PubMed 22552098