Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pCW57.1-4EBP1_4xAla
(Plasmid #38240)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 38240 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCW57.1
  • Backbone manufacturer
    Broad Insitute
  • Backbone size w/o insert (bp) 5000
  • Total vector size (bp) 6000
  • Vector type
    Mammalian Expression, Lentiviral ; Doxycycline inducible

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    4EBP1
  • Alt name
    Eif4Ebp1
  • Species
    R. norvegicus (rat); hybrid gene of rat and human
  • Insert Size (bp)
    357
  • Mutation
    T37A, T46A, S65A, T70A (dominant negative)
  • Entrez Gene
    Eif4ebp1 (a.k.a. PHAS-I)
  • Promoter Tet ON

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Nhe1 (not destroyed)
  • 3′ cloning site BamH1 (not destroyed)
  • 5′ sequencing primer ATAAGCTAGCGATGTCCGGGGGCAGCAGCTGC
  • 3′ sequencing primer GGATGGATCCTTAAATGTCCATCTCAAACTG
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCW57.1-4EBP1_4xAla was a gift from David Sabatini (Addgene plasmid # 38240 ; http://n2t.net/addgene:38240 ; RRID:Addgene_38240)
  • For your References section:

    A unifying model for mTORC1-mediated regulation of mRNA translation. Thoreen CC, Chantranupong L, Keys HR, Wang T, Gray NS, Sabatini DM. Nature. 2012 May 2;485(7396):109-13. doi: 10.1038/nature11083. 10.1038/nature11083 PubMed 22552098