-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 40290 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA3.1
-
Backbone manufacturerInvitrogen
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCalnexin
-
Alt nameCANX
-
SpeciesH. sapiens (human)
- Promoter CMV
-
Tag
/ Fusion Protein
- ddGFP-A (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Addgene sequencing results find I474N in calnexin translation compared to reference sequence NP_001737.1
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCalN-ddGFP-A was a gift from Robert Campbell (Addgene plasmid # 40290 ; http://n2t.net/addgene:40290 ; RRID:Addgene_40290) -
For your References section:
Dimerization-dependent green and yellow fluorescent proteins. Alford SC, Ding Y, Simmen T, Campbell RE. ACS Synth Biol. 2012 Dec 21;1(12):569-75. doi: 10.1021/sb300050j. Epub 2012 Aug 14. 10.1021/sb300050j PubMed 23656278