Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pXL010-Wnt dual (GFP-Fire) reporter
(Plasmid #40588)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 40588 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSicoR PGK Puro
  • Backbone manufacturer
    addgene
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Growth instructions
    18 hrs at 250 rpm
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Wnt reporter sequences
  • Species
    H. sapiens (human), M. musculus (mouse), R. norvegicus (rat), G. gallus (chicken), B. taurus (bovine), X. laevis (frog), D. rerio (zebrafish)
  • Promoter Wnt promoter

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer ccagggatttcagtcgatgt
  • 3′ sequencing primer aatctgacgcaggcagttct
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

This lentiviral Wnt reporter has 7 repeats of Tcf/Lef binding sites, which was cloned by Xiaojun (Lance) Lian.

Methods for Plasmid construction, lentiviral production and infection of hESCs:

The 7 TCF/LEF binding site sequences were obtained by direct PCR of plasmid M50 (Addgene plasmid 12456) and the GreenFire (GF) sequences were obtained by direct PCR of the pGreenFire1-mCMV Plasmid (System Bioscience TR010PA-1). These two sequences were cloned into pSicoR PGK puro (Addgene plasmid 11586) digested by Xba I (NEB) and Xho I (NEB). The constructed Wnt reporter plasmid was named 7TGFP and verified by sequencing. This 7TGFP vector was cotransfected with the helper plasmids psPAX2 and pMD2.G (Addgene plasmids 12260 and 12259) into HEK-293TN cells (System Biosciences) for virus production. Virus-containing medium was collected at 48 and 72 hours after transfection and used for infection of hESCs in the presence of 6μg/mL polybrene (Sigma). Transduced cells were cultured in mTeSR1 on Matrigel for three days and then clonally isolated in mTeSR1 with 1 μg/mL puromycin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pXL010-Wnt dual (GFP-Fire) reporter was a gift from Sean Palecek (Addgene plasmid # 40588 ; http://n2t.net/addgene:40588 ; RRID:Addgene_40588)
  • For your References section:

    Modulation of Wnt/beta-catenin signaling in human embryonic stem cells using a 3-D microwell array. Azarin SM, Lian X, Larson EA, Popelka HM, de Pablo JJ, Palecek SP. Biomaterials. 2012 Mar;33(7):2041-9. Epub 2011 Dec 15. 10.1016/j.biomaterials.2011.11.070 PubMed 22177620