tol2-mpx-cxcr4b whim-gfp
(Plasmid #41089)

• Depositing Lab: Anna Huttenlocher
• Publication: Walters et al Blood. 2010 Oct 14;116(15):2803-11. Epub 2010 Jun 30.

Backbone

• Vector backbone: tol2
• Backbone size w/o insert (bp): 3000
• Total vector size (bp): 13300
• Modifications to backbone: added mpx promoter, truncated cxcr4b, and EGFP
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: CXCR4b-WHIM
• Species: D. rerio (zebrafish)
• Insert Size (bp): 1002
• Mutation: deleted last 19 amino acids of cxcr4b
• Entrez Gene: cxcr4b (a.k.a. CXCR4, cb403, zgc:109863)
• Promoter: mpx
• Tag / Fusion Protein:
  • GFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: MluI (unknown if destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: ccaggtcattgcacaacaccag
• 3′ sequencing primer: gttatccgctcacaattccacac

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • National Institute of Genetics Limited Use Label License for Tol2 System
• Industry Terms:
  • Not Available to Industry