tol2-mpx-cxcr4b whim-gfp
(Plasmid
#41089)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 41089 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonetol2
- Backbone size w/o insert (bp) 3000
- Total vector size (bp) 13300
-
Modifications to backboneadded mpx promoter, truncated cxcr4b, and EGFP
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCXCR4b-WHIM
-
SpeciesD. rerio (zebrafish)
-
Insert Size (bp)1002
-
Mutationdeleted last 19 amino acids of cxcr4b
-
Entrez Genecxcr4b (a.k.a. CXCR4, cb403, zgc:109863)
- Promoter mpx
-
Tag
/ Fusion Protein
- GFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site MluI (unknown if destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer ccaggtcattgcacaacaccag
- 3′ sequencing primer gttatccgctcacaattccacac (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
tol2-mpx-cxcr4b whim-gfp was a gift from Anna Huttenlocher (Addgene plasmid # 41089 ; http://n2t.net/addgene:41089 ; RRID:Addgene_41089) -
For your References section:
Live imaging of neutrophil motility in a zebrafish model of WHIM syndrome. Walters KB, Green JM, Surfus JC, Yoo SK, Huttenlocher A. Blood. 2010 Oct 14;116(15):2803-11. Epub 2010 Jun 30. 10.1182/blood-2010-03-276972 PubMed 20592249