4xCSL-luciferase
(Plasmid #41726)

• Depositing Lab: Raphael Kopan
• Publication: Saxena et al J Biol Chem. 2001 Oct 26;276(43):40268-73. Epub 2001 Aug 22.

Backbone

• Vector backbone: RSV-TATA pGL2
• Backbone manufacturer: Dr. D. Towler (Washington University, St. Louis)
• Modifications to backbone: From pGL2-Basic: Rous sarcoma virus TATA box inserted to reduce basal luciferase activity.
• Vector type: Mammalian Expression, Luciferase

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: 4xCSL binding sites
• Alt name: 4xCBS
• Mutation: Contains a multimerized high affinity CSL binding site (4 x CGTGGGAA)
• Tag / Fusion Protein:
  • Firefly luciferase (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BglII/BamHI (destroyed during cloning)
• 3′ cloning site: Bglll/BamHI (destroyed during cloning)
• 5′ sequencing primer: F1ori-F (GTGGACTCTTGTTCCAAACTGG)
• 3′ sequencing primer: LucNRev

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Plasmid CBF1/pGL2-GLO TATA CAT from Samuel Speck (Emory University, Atlanta, GA) Plasmid RSV-TATA pGL2 from Dwight A. Towler (Washington University School of Medicine, St. Louis, MO)
• Articles Citing this Plasmid:
  • 20 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The 4xCSL-luciferase reporter was constructed from the CBF1/pGL2-GLO TATA CAT plasmid, a gift from Dr. S. Speck. A fragment containing the multimerized high affinity CSL sites (4× CGTGGGAA) was excised by BamHI digest and ligated into a BglII/BamHI-digested RSV-TATA pGL2 vector, a gift from Dr. D. Towler. This modified vector has a TATA box from Rous sarcoma virus inserted into the pGL2-basic vector (Promega) to reduce the basal luciferase activity. Construct was sequenced for verification.

Alternate plasmid name: 4xCBS-luciferase