-
Depositing Labs
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 41723 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGL2-Basic
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 5597
- Total vector size (bp) 6110
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHes1 Promoter (-467 to +46)
-
Alt nameHes1
-
Alt namehairy and enhancer of split 1 Promoter (-467 to +46)
-
Alt namehairy and enhancer of split 1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)513
-
MutationContains the murine Hes1 promoter (-467 to +46)
-
GenBank IDNC_000082.6
-
Entrez GeneHes1 (a.k.a. Hry, bHLHb39)
- Promoter Hes1 promoter fragment (-467 to +46)
-
Tag
/ Fusion Protein
- Firefly luciferase (C terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer F1ori-F (GTGGACTCTTGTTCCAAACTGG)
- 3′ sequencing primer LucNrev (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byPGL2-Basic (under designation "Picagene Basic Vector") obtained from Toyo Ink (Tokyo, Japan).
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Alternate plasmid name: Hes1-Luc
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHes1(467)-luc was a gift from Ryoichiro Kageyama & Raphael Kopan (Addgene plasmid # 41723 ; http://n2t.net/addgene:41723 ; RRID:Addgene_41723) -
For your References section:
Structure, chromosomal locus, and promoter of mouse Hes2 gene, a homologue of Drosophila hairy and Enhancer of split. Nishimura M, Isaka F, Ishibashi M, Tomita K, Tsuda H, Nakanishi S, Kageyama R. Genomics. 1998 Apr 1;49(1):69-75. 10.1006/geno.1998.5213 PubMed 9570950