Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
Holiday Schedule: Addgene will be closed December 24 - January 1, 2020. For more information, see our holiday shipping schedule. If you have any questions, please contact us at [email protected].

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #42213)


Item Catalog # Description Quantity Price (USD)
Plasmid 42213 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 3982
  • Total vector size (bp) 5419
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    High Copy


  • Gene/Insert name
    HYPER C199S
  • Alt name
  • Species
  • Insert Size (bp)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer cggtgggaggtctatataag
  • 3′ sequencing primer tgggaggttttttaaagcaag
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pC1-HyPer-C199S was a gift from Vsevolod Belousov (Addgene plasmid # 42213 ; ; RRID:Addgene_42213)
  • For your References section:

    Genetically encoded fluorescent indicator for intracellular hydrogen peroxide. Belousov VV, Fradkov AF, Lukyanov KA, Staroverov DB, Shakhbazov KS, Terskikh AV, Lukyanov S. Nat Methods. 2006 Apr;3(4):281-6. 10.1038/nmeth866 PubMed 16554833