Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

shBCL2L1 # 1
(Plasmid #42551)

Full plasmid sequence is not available for this item.

Loading...

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 42551 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLKO.1
  • Backbone manufacturer
    TRC
  • Backbone size w/o insert (bp) 8000
  • Vector type
    Mammalian Expression, Lentiviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    shBCL2L1
  • gRNA/shRNA sequence
    GTGGAACTCTATGGGAACAAT
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_001191
  • Entrez Gene
    BCL2L1 (a.k.a. BCL-XL/S, BCL2L, BCLX, Bcl-X, PPP1R52)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Age1 (destroyed during cloning)
  • 3′ cloning site EcoR1 (destroyed during cloning)
  • 5′ sequencing primer pLKOF
  • 3′ sequencing primer pLKOR
  • (Common Sequencing Primers)

Resource Information

  • Addgene Notes
  • A portion of this plasmid was derived from a plasmid made by
    The Broad RNAi consortium (TRC)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

TRCN0000299588

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    shBCL2L1 # 1 was a gift from William Hahn (Addgene plasmid # 42551 ; http://n2t.net/addgene:42551 ; RRID:Addgene_42551)
  • For your References section:

    beta-Catenin-Driven Cancers Require a YAP1 Transcriptional Complex for Survival and Tumorigenesis. Rosenbluh J, Nijhawan D, Cox AG, Li X, Neal JT, Schafer EJ, Zack TI, Wang X, Tsherniak A, Schinzel AC, Shao DD, Schumacher SE, Weir BA, Vazquez F, Cowley GS, Root DE, Mesirov JP, Beroukhim R, Kuo CJ, Goessling W, Hahn WC. Cell. 2012 Dec 21;151(7):1457-73. doi: 10.1016/j.cell.2012.11.026. Epub 2012 Dec 13. 10.1016/j.cell.2012.11.026 PubMed 23245941