Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is operating at a reduced capacity.

  • Pending order? We will email to confirm that your organization can accept shipments.
  • Conducting coronavirus or COVID-19 research? Email us at [email protected] with your order or deposit number so we can prioritize it.

Learn more about our current shipping status and COVID-19 resources.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #42961)


Item Catalog # Description Quantity Price (USD)
Plasmid 42961 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 7788
  • Total vector size (bp) 10701
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
    H. sapiens (human), A. thaliana (mustard weed)
  • Insert Size (bp)
  • Mutation
    LPR6 cytoplasmic domain only
  • Promoter Tet-Off promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SfiI (not destroyed)
  • 3′ cloning site PmeI (not destroyed)
  • 5′ sequencing primer AGACGCCATCCAACGCTGTTT
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CLPIT Cry2PHR-mCh-LRP6c was a gift from David Schaffer (Addgene plasmid # 42961 ; ; RRID:Addgene_42961)
  • For your References section:

    Optogenetic protein clustering and signaling activation in mammalian cells. Bugaj LJ, Choksi AT, Mesuda CK, Kane RS, Schaffer DV. Nat Methods. 2013 Feb 3. doi: 10.1038/nmeth.2360. 10.1038/nmeth.2360 PubMed 23377377