Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pBAD/HisD-TagRFP675
(Plasmid #44274)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 44274 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBAD/HisD
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 3993
  • Total vector size (bp) 4017
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    TagRFP675
  • Species
    Synthetic
  • Insert Size (bp)
    708
  • Mutation
    M41Q/F80W/S143N/L147M/S158N/D159Y/N173S
  • Promoter pBAD

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer atgccatagcatttttatcc
  • 3′ sequencing primer GAT TTA ATC TGT ATC AGG CTG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBAD/HisD-TagRFP675 was a gift from Vladislav Verkhusha (Addgene plasmid # 44274 ; http://n2t.net/addgene:44274 ; RRID:Addgene_44274)
  • For your References section:

    Extended Stokes shift in fluorescent proteins: chromophore-protein interactions in a near-infrared TagRFP675 variant. Piatkevich KD, Malashkevich VN, Morozova KS, Nemkovich NA, Almo SC, Verkhusha VV. Sci Rep. 2013;3:1847. doi: 10.1038/srep01847. 10.1038/srep01847 PubMed 23677204