This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pGL4.75-KRAS LCS6m
(Plasmid #44571)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 44571 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGL4.75
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 4281
  • Total vector size (bp) 8181
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    KRAS 3'UTR
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3900
  • Mutation
    The T allele at LCS6 (let-7 complementary site 6) was changed to the G allele (rs61764370 T>G)
  • GenBank ID
    NM_004985.3
  • Entrez Gene
    KRAS (a.k.a. C-K-RAS, CFC2, K-RAS2A, K-RAS2B, K-RAS4A, K-RAS4B, K-Ras, KI-RAS, KRAS1, KRAS2, NS, NS3, RALD, RASK2, c-Ki-ras2)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xba1 (destroyed during cloning)
  • 3′ cloning site xba1 (destroyed during cloning)
  • 5′ sequencing primer TGACACAGGGAGACTACATTTAATTC
  • 3′ sequencing primer GCCTGAACTAGTTCACAGACAAGG
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

A substitute for pGL3-KRAS LCS6m in Chin et al., 2008.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL4.75-KRAS LCS6m was a gift from Frank Slack (Addgene plasmid # 44571 ; http://n2t.net/addgene:44571 ; RRID:Addgene_44571)