Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCRII_TOPO_hNEAT1
(Plasmid #61518)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 61518 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    PCRII
  • Backbone manufacturer
    Life Technologies
  • Backbone size w/o insert (bp) 4000
  • Total vector size (bp) 7765
  • Vector type
    general cloning vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin and Kanamycin, 100 & 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NEAT1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3700
  • Mutation
    *see comment below
  • GenBank ID
    NR_028272.1
  • Entrez Gene
    NEAT1 (a.k.a. LINC00084, NCRNA00084, TP53LC15, TncRNA, VINC)

Cloning Information

  • Cloning method TOPO Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer CAGGAAACAGCTATGAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

*To create this plasmid, hNEAT1 was amplified from HeLa cDNA. The insert contains two mismatches (C->T at bp 78, and A->G at bp 91, an A->G at bp 1666, and a deletion of TA at bp 2031 and 2032 using the numbering of NR_028272.1) compared to the canonical hNEAT1 sequence. These variants are likely to be encoded in the HeLa genome, as they appeared in multiple clones, but this is yet to be verified by sequencing of HeLa genomic DNA.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCRII_TOPO_hNEAT1 was a gift from Archa Fox (Addgene plasmid # 61518 ; http://n2t.net/addgene:61518 ; RRID:Addgene_61518)
  • For your References section:

    An architectural role for a nuclear noncoding RNA: NEAT1 RNA is essential for the structure of paraspeckles. Clemson CM, Hutchinson JN, Sara SA, Ensminger AW, Fox AH, Chess A, Lawrence JB. Mol Cell. 2009 Mar 27;33(6):717-26. doi: 10.1016/j.molcel.2009.01.026. Epub 2009 Feb 12. 10.1016/j.molcel.2009.01.026 PubMed 19217333