pX335-NEAT1_IS_v2
(Plasmid
#97086)
-
PurposeEncodes an sgRNA that creates a SSB near the poly(A) site of human NEAT1_1 isoform.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 97086 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepX335
-
Backbone manufacturerFeng Zhang (Addgene #42235)
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA NEAT1_IS_v2
-
gRNA/shRNA sequenceCACCGCTTTATTTGTGCTGTAAAG
-
SpeciesH. sapiens (human)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer CATATGCTTACCGTAAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX335-NEAT1_IS_v2 was a gift from Archa Fox (Addgene plasmid # 97086 ; http://n2t.net/addgene:97086 ; RRID:Addgene_97086) -
For your References section:
Functional dissection of NEAT1 using genome editing reveals substantial localisation of the NEAT1_1 isoform outside paraspeckles. Li R, Harvey AR, Hodgetts SI, Fox AH. RNA. 2017 Mar 21. pii: rna.059477.116. doi: 10.1261/rna.059477.116. 10.1261/rna.059477.116 PubMed 28325845