LZRS-HOTAIR
(Plasmid #26110)

• Depositing Lab: Howard Chang
• Publication: Gupta et al Nature. 2010 Apr 15. 464(7291):1071-6.

Ordering

Item	Catalog #	Description	Quantity	Price (USD)
Plasmid	26110	Standard format: Plasmid sent in bacteria as agar stab	1	$65	Add to Cart

This material is available to academics and nonprofits only.

Backbone

• Vector backbone: LZRS
  (Search Vector Database)
• Backbone size w/o insert (bp): 11100
• Vector type: Retroviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin
• Growth Temperature: 37°C
• Growth Strain(s): Stbl2
• Growth instructions: STBL2
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: HOTAIR
• Species: H. sapiens (human)
• Insert Size (bp): 2146
• Entrez Gene: HOTAIR (a.k.a. HOXAS, HOXC-AS4, HOXC11-AS1, NCRNA00072)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ cloning site: attR (destroyed during cloning)
• 3′ cloning site: attR (destroyed during cloning)
• 5′ sequencing primer: TGGATACACGCCGCCCACGTG
• 3′ sequencing primer: ATCGTCGACCACTGTGCTGG

Resource Information

• Terms and Licenses:
  • UBMTA
• Articles Citing this Plasmid:
  • 10 References