-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 26110 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneLZRS
- Backbone size w/o insert (bp) 11100
-
Vector typeRetroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)Stbl2
-
Growth instructionsSTBL2
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameHOTAIR
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2146
-
Entrez GeneHOTAIR (a.k.a. HOXAS, HOXC-AS4, HOXC11-AS1, NCRNA00072)
Cloning Information
- Cloning method Gateway Cloning
- 5′ cloning site attR (destroyed during cloning)
- 3′ cloning site attR (destroyed during cloning)
- 5′ sequencing primer TGGATACACGCCGCCCACGTG
- 3′ sequencing primer ATCGTCGACCACTGTGCTGG (Common Sequencing Primers)
Resource Information
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
-
Articles Citing this Plasmid
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LZRS-HOTAIR was a gift from Howard Chang (Addgene plasmid # 26110 ; http://n2t.net/addgene:26110 ; RRID:Addgene_26110) -
For your References section:
Long non-coding RNA HOTAIR reprograms chromatin state to promote cancer metastasis. Gupta RA, Shah N, Wang KC, Kim J, Horlings HM, Wong DJ, Tsai MC, Hung T, Argani P, Rinn JL, Wang Y, Brzoska P, Kong B, Li R, West RB, van de Vijver MJ, Sukumar S, Chang HY. Nature. 2010 Apr 15. 464(7291):1071-6. 10.1038/nature08975 PubMed 20393566