1
Plasmid 26110: LZRS-HOTAIR
  • HOTAIR

  • 2146

  • H. sapiens (human)

  • HOTAIR (HOXAS, FLJ41747, HOXC11-AS1, NCRNA00072)

  • LZRS
    (Search Vector Database)

  • Retroviral

  • 11100

  • Gateway Cloning

  • attR

  • Yes

  • attR

  • Yes

  • TGGATACACGCCGCCCACGTG List of Sequencing Primers

  • ATCGTCGACCACTGTGCTGG

  • Ampicillin

  • Stbl2

  • 37

  • STBL2

  • Low Copy

  • Puromycin

  • View sequences (1)
  • Howard Chang

  • MTA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Long non-coding RNA HOTAIR reprograms chromatin state to promote cancer metastasis. Gupta et al (Nature. 2010 Apr 15. 464(7291):1071-6. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 26110" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only