Holiday Schedule: Addgene will be closed December 22nd & 25th and January 1st. For details, see our holiday shipping schedule. If you have any questions, please contact us at [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

LZRS-Rfa
(Plasmid #31601)

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 31601 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    LZRS-RfA
  • Backbone manufacturer
    Khavari Lab
  • Backbone size (bp) 11100
  • Vector type
    Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    None

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ cloning site attR (not destroyed)
  • 3′ cloning site attR (not destroyed)
  • 5′ sequencing primer LZRS-F (TGGATACACGCCGCCCACGTG)
  • 3′ sequencing primer LZRS-R (ATCGTCGACCACTGTGCTGG)
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LZRS-Rfa was a gift from Paul Khavari (Addgene plasmid # 31601)
  • For your References section:

    Mek1 alters epidermal growth and differentiation. Scholl FA, Dumesic PA, Khavari PA. Cancer Res. 2004 Sep 1;64(17):6035-40 10.1158/0008-5472.CAN-04-0017 PubMed 15342384