Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #45247)


Item Catalog # Description Quantity Price (USD)
Plasmid 45247 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 12500
  • Total vector size (bp) 13442
  • Modifications to backbone
    inserted utrophin
  • Vector type
    zebrafish expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Mutation
    contains amino acids 1-261 of NP_009055.2; Q236R
  • Entrez Gene
    UTRN (a.k.a. DMDL, DRP, DRP1)
  • Promoter mpx
  • Tag / Fusion Protein
    • EGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NcoI (not destroyed)
  • 5′ sequencing primer TAGGGATCCGGTAGGCGTGTA
  • 3′ sequencing primer tgaacagctcctcgccctt
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mpx:UtrCH-GFP was a gift from Anna Huttenlocher (Addgene plasmid # 45247 ; ; RRID:Addgene_45247)
  • For your References section:

    Differential regulation of protrusion and polarity by PI3K during neutrophil motility in live zebrafish. Yoo SK, Deng Q, Cavnar PJ, Wu YI, Hahn KM, Huttenlocher A. Dev Cell. 2010 Feb 16. 18(2):226-36. 10.1016/j.devcel.2009.11.015 PubMed 20159593