pNK-TGCK
(Plasmid #45359)

• Depositing Lab: Sean Wu
• Publication: Sean Wu lab plasmids (unpublished)

Backbone

• Vector backbone: pEGFP-1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4200
• Total vector size (bp): 10855
• Modifications to backbone: Mouse 2.5 kb Nkx cardiac enhancer and promoter fragment present upstream of tTA. Cre recombinase present (fused) downstream of EGFP, driven by a minimal TetO-CMV promoter
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: tTA
• Alt name: tetracycline-responsive activator
• Insert Size (bp): 850
• Promoter: Mouse Nkx2.5 cardiac enhancer and promoter fragment

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: Unknown
• 3′ sequencing primer: hGH-pA-R (CCAGCTTGGTTCCCAATAGA)

Gene/Insert 2

• Gene/Insert name: eGFP-Cre
• Alt name: EGFP
• Alt name: Cre recombinase
• Insert Size (bp): 1800
• Promoter: minimal TetO-CMV promoter

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: EGFP-C

Resource Information

• Supplemental Documents:
  • pNK-TGCK supplemental sequence information
• A portion of this plasmid was derived from a plasmid made by: 2.1 kb murine Nkx2.5 enhancer fragment from Dr. Eric Olson, UT Southwestern, Dallas, TX, by MTA with Children's Hospital, Boston, MA. A portion of the plasmid derived from DNA provided by Andrew McMahon, Harvard University.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Alternate plasmid name: Nkx2.5 cardiac enhancer-tTA-TetO-CMV min-Cre-eGFP (TGCK)

Plasmid full sequence is approximated and may not be entirely accurate.