Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #45359)


Item Catalog # Description Quantity Price (USD)
Plasmid 45359 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 4200
  • Total vector size (bp) 10855
  • Modifications to backbone
    Mouse 2.5 kb Nkx cardiac enhancer and promoter fragment present upstream of tTA. Cre recombinase present (fused) downstream of EGFP, driven by a minimal TetO-CMV promoter
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number

Gene/Insert 1

  • Gene/Insert name
  • Alt name
    tetracycline-responsive activator
  • Insert Size (bp)
  • Promoter Mouse Nkx2.5 cardiac enhancer and promoter fragment

Cloning Information for Gene/Insert 1

  • Cloning method Unknown
  • 5′ sequencing primer Unknown
  • 3′ sequencing primer hGH-pA-R (CCAGCTTGGTTCCCAATAGA)
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
  • Alt name
  • Alt name
    Cre recombinase
  • Insert Size (bp)
  • Promoter minimal TetO-CMV promoter

Cloning Information for Gene/Insert 2

Resource Information

Depositor Comments

Alternate plasmid name: Nkx2.5 cardiac enhancer-tTA-TetO-CMV min-Cre-eGFP (TGCK)

Plasmid full sequence is approximated and may not be entirely accurate.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pNK-TGCK was a gift from Sean Wu (Addgene plasmid # 45359 ; ; RRID:Addgene_45359)