-
PurposeExpresses yeast Flp driven by the constitutive promoter pE from phage P2
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 45978 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepKD46
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 50 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)E811 (P2 lysogen)
-
Growth instructionsFor propagation, please grow this plasmid in the original strain (E811). In that strain, the strong promoter pE will be repressed, thus avoiding possible toxicity and accumulation of unwanted mutations in the plasmid. Use 50 µg/mL ampicillin (100 µg/mL may inhibit growth)
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameflp
-
Alt nameflippase
-
Insert Size (bp)1272
-
Mutationflp driven by the constitutive promoter pE from phage P2
- Promoter pE (from phage P2)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GGAATAAGGGCGACACGGAAATGTTGAATA
- 3′ sequencing primer CCGTTACATATCAAAGGGAAAACTGTCC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe flippase gene was amplified from pCP20 (e.g. available from the Coli Genetic Stock Center)
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Can be used to remove the integration module (including the antibiotic resistance cassette) from pOSIP integrants.
Reference:
St-Pierre F, Cui L et al., "One-step cloning and chromosomal integration of DNA", ACS Synthetic Biology, http://pubs.acs.org/doi/abs/10.1021/sb400021j
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pE-FLP was a gift from Drew Endy & Keith Shearwin (Addgene plasmid # 45978 ; http://n2t.net/addgene:45978 ; RRID:Addgene_45978) -
For your References section:
One-step cloning and chromosomal integration of DNA. St-Pierre F, Cui L, Priest DG, Endy D, Dodd IB, Shearwin KE. ACS Synth Biol. 2013 Sep 20;2(9):537-41. doi: 10.1021/sb400021j. Epub 2013 May 20. 10.1021/sb400021j PubMed 24050148