Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pQUASp-mCD8GFP
(Plasmid #46163)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 46163 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pQUASp
  • Backbone size w/o insert (bp) 9896
  • Total vector size (bp) 11285
  • Vector type
    Insect Expression
  • Selectable markers
    white

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    mCD8GFP
  • Alt name
    mouseCD8
  • Alt name
    GFP
  • Alt name
    CD8
  • Species
    M. musculus (mouse), Synthetic
  • Insert Size (bp)
    1389

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer TTTGAAAACCGGTGATAGAGCCTG
  • 3′ sequencing primer ACCAGGGGATGCTTAATTGTGTTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pQUASp-mCD8GFP was a gift from Christopher Potter (Addgene plasmid # 46163 ; http://n2t.net/addgene:46163 ; RRID:Addgene_46163)
  • For your References section:

    Organization of olfactory centres in the malaria mosquito Anopheles gambiae. Riabinina O, Task D, Marr E, Lin CC, Alford R, O'Brochta DA, Potter CJ. Nat Commun. 2016 Oct 3;7:13010. doi: 10.1038/ncomms13010. 10.1038/ncomms13010 PubMed 27694947