pQUASp-mCD8GFP
(Plasmid #46163)

• Purpose: Expression of murine CD8GFP in insects
• Depositing Lab: Christopher Potter
• Publication: pQUASp plasmids for germline expression (unpublished)

Ordering

Item	Catalog #	Description	Quantity	Price (USD)
Plasmid	46163	Standard format: Plasmid sent in bacteria as agar stab	1	$75	Add to Cart

This material is available to academics and nonprofits only.

Backbone

• Vector backbone: pQUASp
  (Search Vector Database)
• Backbone size w/o insert (bp): 9896
• Total vector size (bp): 11285
• Vector type: Insect Expression
• Selectable markers: white

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: mCD8GFP
• Alt name: mouseCD8
• Alt name: GFP
• Alt name: CD8
• Species: M. musculus (mouse), Synthetic
• Insert Size (bp): 1389

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: TTTGAAAACCGGTGATAGAGCCTG
• 3′ sequencing primer: ACCAGGGGATGCTTAATTGTGTTC

Resource Information

• Supplemental Documents:
  • pQUASP-mCD8GFP.gb
• Terms and Licenses:
  • UBMTA
  • Ancillary Agreement for Plasmids Containing FP Materials
• Industry Terms:
  • Not Available to Industry