pQUASp-RedStinger (nlsRFP)
(Plasmid
#46165)
-
Purpose(Empty Backbone) Expression of RedStinger in insect
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 46165 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepQUASp
- Backbone size (bp) 9929
-
Vector typeInsect Expression
-
Selectable markerswhite
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRedStinger
-
Alt namenlsRFP
-
Alt namenuclearRFP
-
Alt namenlsDsRed
-
Insert Size (bp)821
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer TTTGAAAACCGGTGATAGAGCCTG
- 3′ sequencing primer ACCAGGGGATGCTTAATTGTGTTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pQUASp-RedStinger (nlsRFP) was a gift from Christopher Potter (Addgene plasmid # 46165 ; http://n2t.net/addgene:46165 ; RRID:Addgene_46165)