This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

5xGAL4-TATA-luciferase
(Plasmid #46756)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 46756 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSV232AL-AD5
  • Total vector size (bp) 6300
  • Modifications to backbone
    delete SV40 promoter and add 2xSV40 polyadenylation sits, 5xGAL4 binding sites and a minimal TATA promoter upstream of luciferase
  • Vector type
    Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Luciferase
  • Species
    Firefly
  • Insert Size (bp)
    1729
  • Promoter minimal TATA

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer TGTGTCAGAGGTTTTCACCGT
  • 3′ sequencing primer CGAAAAGTGCCACCTGACGTCT
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

de Wet et al, MCB, 7: 725-737, 1987.

Note that there are some minor discrepancies between Addgene's quality control sequence and the depositor's assembled sequence. These differences should not affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    5xGAL4-TATA-luciferase was a gift from Richard Maurer (Addgene plasmid # 46756 ; http://n2t.net/addgene:46756 ; RRID:Addgene_46756)
  • For your References section:

    Differential activation of CREB by Ca2+/calmodulin-dependent protein kinases type II and type IV involves phosphorylation of a site that negatively regulates activity. Sun P, Enslen H, Myung PS, Maurer RA. Genes Dev. 1994 Nov 1;8(21):2527-39. 10.1101/gad.8.21.2527 PubMed 7958915