Skip to main content

pVC228 VEGF Site#3
(Plasmid #47507)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 47507 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    MLM3636
  • Backbone manufacturer
    Joung lab (Addgene plasmid #43860)
  • Backbone size w/o insert (bp) 2278
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    gRNA-VEGF site 3
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    20
  • Entrez Gene
    VEGFA (a.k.a. L-VEGF, MVCD1, VEGF, VPF)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (not destroyed)
  • 3′ cloning site BsmBI (not destroyed)
  • 5′ sequencing primer hU6-F (5'-GAGGGCCTATTTCCCATGATT-3')
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Target site: GGTGAGTGAGTGTGTGCGTG

gRNA expression vector targeting human VEGF for use with JDS246 (Addgene plasmid# 43861--mammalian codon-optimized streptococcus pyogenes Cas9)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pVC228 VEGF Site#3 was a gift from Keith Joung (Addgene plasmid # 47507 ; http://n2t.net/addgene:47507 ; RRID:Addgene_47507)
  • For your References section:

    High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Fu Y, Foden JA, Khayter C, Maeder ML, Reyon D, Joung JK, Sander JD. Nat Biotechnol. 2013 Jun 23. doi: 10.1038/nbt.2623. 10.1038/nbt.2623 PubMed 23792628