pET-PesaRlux
(Plasmid #47802)

• Purpose: PesaR promoter, luxCDABE, and terminator in pET17b (AmpR)
• Depositing Lab: Cynthia Collins
• Publication: Shong et al ACS Synth Biol. 2013 Jul 23.

Backbone

• Vector backbone: pET-17b
• Backbone manufacturer: Novagen
• Backbone size w/o insert (bp): 2934
• Total vector size (bp): 9177
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: PesaR-luxCDABE-term
• Insert Size (bp): 6243
• Promoter: PesaR

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: cgaaaagtgccacctgacgtctaag
• 3′ sequencing primer: aatcatcactttcgggaa

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

PesaR-luxCDABE-transcriptional terminator fragment from pCS-PesaRlux is between XhoI and BglII sites in pET17b.

PesaR (274bp, indicated as lowercase letters in the 2nd partial sequence for PesaR between XhoI and BamHI) is located between XhoI and BamHI sites. luxCDABE is located between two NotI sites. The transcriptional terminator is located downstream of luxCDABE between the second NotI and BglII.

Sequencing primers provided were used to sequence PesaR.