Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pOTTC351 - pAAV CaMKIIa hChR2(H134R)-iRFP
(Plasmid #47905)


Item Catalog # Description Quantity Price (USD)
Plasmid 47905 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Karl Deisseroth
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
    Channel Rhodopsin 2
  • Mutation
  • GenBank ID
  • Promoter CaMKIIa
  • Tag / Fusion Protein
    • iRFP (C terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CaMKIIa prom F1221 (5'CGTCAGTCAAGCCGGTTCTC)
  • 3′ sequencing primer WPRE_R1 (5'ATGAAAGCCATACGGGAAGC)
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    the ORF for iRFP was obtained from Addgene (Plasmid 31857). the backbone was obtained from Karl Deisseroth, but is also available from Addgene (Plasmid 26969).
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
  • Article Citing this Plasmid
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pOTTC351 - pAAV CaMKIIa hChR2(H134R)-iRFP was a gift from Brandon Harvey (Addgene plasmid # 47905 ; ; RRID:Addgene_47905)
  • For your References section:

    Near-infrared fluorescent protein iRFP713 as a reporter protein for optogenetic vectors, a transgenic Cre-reporter rat, and other neuronal studies. Richie CT, Whitaker LR, Whitaker KW, Necarsulmer J, Baldwin HA, Zhang Y, Fortuno L, Hinkle JJ, Koivula P, Henderson MJ, Sun W, Wang K, Smith JC, Pickel J, Ji N, Hope BT, Harvey BK. J Neurosci Methods. 2017 Jun 1;284:1-14. doi: 10.1016/j.jneumeth.2017.03.020. Epub 2017 Apr 2. 10.1016/j.jneumeth.2017.03.020 PubMed 28380331