pTrex-Luc-Phleo
(Plasmid
#48337)
-
PurposeTrasgenically expresses firefly luciferase in T. cruzi with phleomycin selection
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 48337 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 * |
* Login to view industry pricing.
Backbone
-
Vector backbonepTrex
-
Backbone manufacturerMartin P. Vazquez
- Backbone size w/o insert (bp) 6200
- Total vector size (bp) 7900
-
Modifications to backboneLuciferase inserted in MCS through HindIII and XhoI.
-
Vector typeTrypanasoma cruzi expression
-
Selectable markersPhleomycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namefirely luciferase
-
SpeciesPhotinus pyralis
-
Insert Size (bp)1700
- Promoter T. cruzi rRNA
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (unknown if destroyed)
- 3′ cloning site XhoI (unknown if destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTrex-Luc-Phleo was a gift from Rick Tarleton (Addgene plasmid # 48337 ; http://n2t.net/addgene:48337 ; RRID:Addgene_48337)