Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #68709)


Item Catalog # Description Quantity Price (USD)
Plasmid 68709 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Vazquez and Levin., 1999
  • Backbone size w/o insert (bp) 5900
  • Total vector size (bp) 7300
  • Modifications to backbone
    tdTomato synthetic gene (1431 bp) was cloned by restriction sites XbaI and HindIII into pTREX-b (with blasticidin resistance marker).
  • Vector type
    Expression of tdTomato red fluorescence protein in Trypanosoma cruzi
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
  • Insert Size (bp)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer 5’- CAATTCTAGAATGGTTTCCAAGGGTGAGGA -3’
  • 3′ sequencing primer 5’- GCAGAAGCTTTTACTTGTACAACTCGTCCA -3’
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    tdTomato/pTREX-b was a gift from Roberto Docampo (Addgene plasmid # 68709 ; ; RRID:Addgene_68709)
  • For your References section:

    CRISPR/Cas9-Induced Disruption of Paraflagellar Rod Protein 1 and 2 Genes in Trypanosoma cruzi Reveals Their Role in Flagellar Attachment. Lander N, Li ZH, Niyogi S, Docampo R. MBio. 2015 Jul 21;6(4). pii: e01012-15. doi: 10.1128/mBio.01012-15. 10.1128/mBio.01012-15 PubMed 26199333