tdTomato/pTREX-b
(Plasmid
#68709)
-
PurposeExpresses tdTomato in pTREX-b vector which confers resistance to blasticidin. This vector is used for cloning a specific sgRNA by BamHI, to transfect Cas9-expressing Trypanosoma cruzi epimastigotes.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 68709 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepTREX-b
-
Backbone manufacturerVazquez and Levin., 1999
- Backbone size w/o insert (bp) 5900
- Total vector size (bp) 7300
-
Modifications to backbonetdTomato synthetic gene (1431 bp) was cloned by restriction sites XbaI and HindIII into pTREX-b (with blasticidin resistance marker).
-
Vector typeExpression of tdTomato red fluorescence protein in Trypanosoma cruzi
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nametdTomato
-
SpeciesSynthetic
-
Insert Size (bp)1431
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer 5’- CAATTCTAGAATGGTTTCCAAGGGTGAGGA -3’
- 3′ sequencing primer 5’- GCAGAAGCTTTTACTTGTACAACTCGTCCA -3’ (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThis gene was subcloned by Dr. Noelia Lander in my laboratory.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
tdTomato/pTREX-b was a gift from Roberto Docampo (Addgene plasmid # 68709 ; http://n2t.net/addgene:68709 ; RRID:Addgene_68709) -
For your References section:
CRISPR/Cas9-Induced Disruption of Paraflagellar Rod Protein 1 and 2 Genes in Trypanosoma cruzi Reveals Their Role in Flagellar Attachment. Lander N, Li ZH, Niyogi S, Docampo R. MBio. 2015 Jul 21;6(4). pii: e01012-15. doi: 10.1128/mBio.01012-15. 10.1128/mBio.01012-15 PubMed 26199333