Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
Holiday Schedule: Addgene will be closed December 24 - January 1, 2020. For more information, see our holiday shipping schedule. If you have any questions, please contact us at [email protected].

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #49055)


Item Catalog # Description Quantity Price (USD)
Plasmid 49055 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
    adeno-associated viral (AAVsp)
  • Backbone size w/o insert (bp) 6204
  • Total vector size (bp) 7074
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
    Enhanced Green Fluorescent Protein
  • Species
    Aequorea victoria green
  • Insert Size (bp)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SfiI (not destroyed)
  • 3′ cloning site PmeI (not destroyed)
  • 5′ sequencing primer tagccacaccagccaccact
  • 3′ sequencing primer caacgtgctggtctgtgtg
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Expression of GFP is driven by a CMV promoter with a splice donor/acceptor sequence (SD/SA) and flanked by inverted terminal repeats (ITRs).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV GFP was a gift from Fred Gage (Addgene plasmid # 49055 ; ; RRID:Addgene_49055)
  • For your References section:

    Adeno-associated virus effectively mediates conditional gene modification in the brain. Kaspar BK, Vissel B, Bengoechea T, Crone S, Randolph-Moore L, Muller R, Brandon EP, Schaffer D, Verma IM, Lee KF, Heinemann SF, Gage FH. Proc Natl Acad Sci U S A. 2002 Feb 19;99(4):2320-5. Epub 2002 Feb 12. 10.1073/pnas.042678699 PubMed 11842206