AAV-GFP/Cre
(Plasmid #49056)

• Purpose: adeno-associated virus (AAV) encoding a green fluorescent protein/Cre recombinase (GFP/Cre) fusion protein.
• Depositing Lab: Fred Gage
• Publication: Kaspar et al Proc Natl Acad Sci U S A. 2002 Feb 19;99(4):2320-5. Epub 2002 Feb 12.

Backbone

• Vector backbone: adeno-associated viral (AAVsp)
• Backbone size w/o insert (bp): 6165
• Total vector size (bp): 8002
• Vector type: Mammalian Expression, Mouse Targeting, AAV, Cre/Lox

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Cre
• Alt name: GFP-NLS-Cre
• Alt name: green fluorescent protein Cre recombinase (GFP/Cre) fusion protein
• Species: M. musculus (mouse); Aequorea victoria green
• Insert Size (bp): 1837
• Promoter: CMV
• Tags / Fusion Proteins:
  • EGFP (N terminal on insert)
  • Myc (N terminal on insert)
  • NLS (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: PmlI (destroyed during cloning)
• 3′ cloning site: XhoI (destroyed during cloning)
• 5′ sequencing primer: tagccacaccagccaccact
• 3′ sequencing primer: caacgtgctggtctgtgtg

Resource Information

• Supplemental Documents:
  • AAV sp map
• Articles Citing this Plasmid:
  • 16 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Encodes an N-terminal GFP, Myc-tag fused in-frame to an SV40 nuclear localization signal (NLS) and Cre recombinase (AAV-GFP/Cre).

Expression is driven by a CMV promoter with a splice donor/acceptor sequence (SD/SA) and flanked by inverted terminal repeats (ITRs). High titer, purified virus prepared from this plasmid can be used for stereotaxic injection into adult ROSA26 reporter mice.