Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

Twitch-2B pcDNA3
(Plasmid #49531)


Item Catalog # Description Quantity Price (USD)
Plasmid 49531 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 5400
  • Total vector size (bp) 7000
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    Low Copy


  • Gene/Insert name
  • Alt name
  • Species
    Opsanus tau
  • Insert Size (bp)
  • Promoter CMV
  • Tags / Fusion Proteins
    • ECFP (N terminal on insert)
    • cpCit174 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer ccgcggccGCCACCATGGTGAGCAAG
  • 3′ sequencing primer acattgaggattgagaattc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Depositor Comments

There is a discrepancy in the publication, Plasmid 48203: Twitch-2B pRSETB and Plasmid 49531: Twitch-2B pcDNA3 are misidentified.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Twitch-2B pcDNA3 was a gift from Oliver Griesbeck (Addgene plasmid # 49531 ; ; RRID:Addgene_49531)
  • For your References section:

    Optimized ratiometric calcium sensors for functional in vivo imaging of neurons and T lymphocytes. Thestrup T, Litzlbauer J, Bartholomaus I, Mues M, Russo L, Dana H, Kovalchuk Y, Liang Y, Kalamakis G, Laukat Y, Becker S, Witte G, Geiger A, Allen T, Rome LC, Chen TW, Kim DS, Garaschuk O, Griesinger C, Griesbeck O. Nat Methods. 2014 Jan 5. doi: 10.1038/nmeth.2773. 10.1038/nmeth.2773 PubMed 24390440