lentiCRISPR
(Plasmid #49535)

• Purpose: This vector has been discontinued as of 5/8/2014. See Comments below for information on the updated version of the lentiCRISPR vector.
• Depositing Lab: Feng Zhang
• Publication: Shalem et al Science. 2014 Jan 3;343(6166):84-7. doi: 10.1126/science.1247005. Epub 2013 Dec 12.

Backbone

• Vector backbone: pLKO_TRC005
• Vector type: Lentiviral, CRISPR
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Growth instructions: Use SapI digest to check for unwanted recombination of lentiviral plasmid. Only amplify in RecA- bacteria (eg. Stbl3).
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Cas9
• Alt name: S. pyogenes CRISPR-Cas9
• Species: Synthetic
• Insert Size (bp): 4200
• Promoter: EFS

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: NheI (not destroyed)
• 5′ sequencing primer: GGTACAGTGCAGGGGAAAGA
• 3′ sequencing primer: TGCCCTCCAAATATGTGAACT

Gene/Insert 2

• Gene/Insert name: Puromycin resistance
• Alt name: puromycin N-acetyl-transferase
• Alt name: PAC
• Insert Size (bp): 600
• Promoter: EFS

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: MluI (not destroyed)
• 5′ sequencing primer: TGCTGCTACTAAGAAAGCTGGTC

Resource Information

• Supplemental Documents:
  • LentiCRISPR sgRNA protocol
  • LentiCRISPR annotated Genbank file
• Addgene Notes:
  • Addgene diagnostic digest

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

AS OF 5/8/2014, THIS VECTOR IS DISCONTINUED. Version 2 of the lentiCRISPR vector can be found here: http://www.addgene.org/52961

There is also now a 2 plasmid lentiviral CRISPR system from the Zhang lab with the Cas9 and gRNA on separate plasmids:

http://www.addgene.org/52962

http://www.addgene.org/52963