pACM4-ACA
(Plasmid
#49809)
-
PurposeEncodes fabD, accA, accB, accC, accD in pseudo-operon configuration.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 49809 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepACM4
- Backbone size w/o insert (bp) 3956
- Total vector size (bp) 9262
-
Modifications to backboneSee paper.
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameACP transacylase
-
Alt namefabD
-
SpeciesE. coli
-
Insert Size (bp)930
-
MutationSilent site-directed mutagenesis to remove SalI site (GTCGAC to GTGGAC)
-
GenBank IDCDJ71527.1
- Promoter T7
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site AvrII (destroyed during cloning)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer GACGCAATTTGCATTTGTGTTCC
- 3′ sequencing primer GAGATGTTCTACGCCTTGCG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameAcetyl-CoA carboxylase
-
Alt nameaccA
-
SpeciesE. coli K-12
-
Insert Size (bp)957
-
GenBank IDCDJ70765.1
- Promoter T7
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site AvrII (destroyed during cloning)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer CGGTTAGCCGTCAGGATGAG
- 3′ sequencing primer CGCGTAACCGTAGCTCATC (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameacetyl-CoA carboxylase
-
Alt nameaccB
-
SpeciesE. coli K-12
-
Insert Size (bp)468
-
GenBank IDCDJ73611.1
- Promoter T7
Cloning Information for Gene/Insert 3
- Cloning method Restriction Enzyme
- 5′ cloning site AvrII (destroyed during cloning)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer CTGATCGAGCTGGTTGAAG
- 3′ sequencing primer TTACTCGATGACGACCAGC (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert nameAcetyl-CoA carboxylase
-
Alt nameaccC
-
SpeciesE. coli
-
Insert Size (bp)1347
-
GenBank IDCDJ73610.1
- Promoter T7
Cloning Information for Gene/Insert 4
- Cloning method Restriction Enzyme
- 5′ cloning site AvrII (destroyed during cloning)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer GTTATTGCCAACCGCGG
- 3′ sequencing primer CCAGATAGTGGATGTTAGTGCC (Common Sequencing Primers)
Gene/Insert 5
-
Gene/Insert nameAcetyl-CoA carboxylase
-
Alt nameaccD
-
SpeciesE. coli K-12
-
Insert Size (bp)912
-
GenBank IDCDJ72671.1
- Promoter T7
Cloning Information for Gene/Insert 5
- Cloning method Restriction Enzyme
- 5′ cloning site AvrII (destroyed during cloning)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer GCAACATTACTCCCACCCG
- 3′ sequencing primer CAGGCCTCAGGTTCCTGATC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pACM4-ACA was a gift from Mattheos Koffas (Addgene plasmid # 49809 ; http://n2t.net/addgene:49809 ; RRID:Addgene_49809) -
For your References section:
Modular optimization of multi-gene pathways for fatty acids production in E. coli. Xu P, Gu Q, Wang W, Wong L, Bower AG, Collins CH, Koffas MA. Nat Commun. 2013;4:1409. doi: 10.1038/ncomms2425. 10.1038/ncomms2425 PubMed 23361000