pACM4-ACA
(Plasmid #49809)

• Purpose: Encodes fabD, accA, accB, accC, accD in pseudo-operon configuration.
• Depositing Lab: Mattheos Koffas
• Publication: Xu et al Nat Commun. 2013;4:1409. doi: 10.1038/ncomms2425.

Backbone

• Vector backbone: pACM4
• Backbone size w/o insert (bp): 3956
• Total vector size (bp): 9262
• Modifications to backbone: See paper.
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: ACP transacylase
• Alt name: fabD
• Species: E. coli
• Insert Size (bp): 930
• Mutation: Silent site-directed mutagenesis to remove SalI site (GTCGAC to GTGGAC)
• GenBank ID: CDJ71527.1
• Promoter: T7

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: AvrII (destroyed during cloning)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: GACGCAATTTGCATTTGTGTTCC
• 3′ sequencing primer: GAGATGTTCTACGCCTTGCG

Gene/Insert 2

• Gene/Insert name: Acetyl-CoA carboxylase
• Alt name: accA
• Species: E. coli K-12
• Insert Size (bp): 957
• GenBank ID: CDJ70765.1
• Promoter: T7

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: AvrII (destroyed during cloning)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: CGGTTAGCCGTCAGGATGAG
• 3′ sequencing primer: CGCGTAACCGTAGCTCATC

Gene/Insert 3

• Gene/Insert name: acetyl-CoA carboxylase
• Alt name: accB
• Species: E. coli K-12
• Insert Size (bp): 468
• GenBank ID: CDJ73611.1
• Promoter: T7

Cloning Information for Gene/Insert 3

• Cloning method: Restriction Enzyme
• 5′ cloning site: AvrII (destroyed during cloning)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: CTGATCGAGCTGGTTGAAG
• 3′ sequencing primer: TTACTCGATGACGACCAGC

Gene/Insert 4

• Gene/Insert name: Acetyl-CoA carboxylase
• Alt name: accC
• Species: E. coli
• Insert Size (bp): 1347
• GenBank ID: CDJ73610.1
• Promoter: T7

Cloning Information for Gene/Insert 4

• Cloning method: Restriction Enzyme
• 5′ cloning site: AvrII (destroyed during cloning)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: GTTATTGCCAACCGCGG
• 3′ sequencing primer: CCAGATAGTGGATGTTAGTGCC

Gene/Insert 5

• Gene/Insert name: Acetyl-CoA carboxylase
• Alt name: accD
• Species: E. coli K-12
• Insert Size (bp): 912
• GenBank ID: CDJ72671.1
• Promoter: T7

Cloning Information for Gene/Insert 5

• Cloning method: Restriction Enzyme
• 5′ cloning site: AvrII (destroyed during cloning)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: GCAACATTACTCCCACCCG
• 3′ sequencing primer: CAGGCCTCAGGTTCCTGATC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry