SRAcode_in_pUC57_v3(767-1356)
(Plasmid #49826)

• Purpose: for transcribing SRA nucl 767-1356 of NM_001035235 with T7
• Depositing Lab: Thomas Cech
• Publication: McKay et al J Mol Biol. 2014 Apr 17;426(8):1766-85. doi: 10.1016/j.jmb.2014.01.006. Epub 2014 Jan 30.

Backbone

• Vector backbone: pUC57
• Backbone manufacturer: unknown
• Backbone size w/o insert (bp): 2710
• Total vector size (bp): 3071
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): XL10 Gold
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: steroid receptor RNA activator RNA coding
• Alt name: SRA
• Species: H. sapiens (human)
• Insert Size (bp): 590
• Mutation: KpnI site at 5' start of RNA coding seq
• GenBank ID: NM_001035235
• Entrez Gene: SRA1 (a.k.a. SRA, SRAP, STRAA1, pp7684)
• Promoter: T7

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: GGCTTAACTATGCGGCATCAGAGC
• 3′ sequencing primer: CAGCTATGACCATGATTACGCC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry