pME-puro-Venus-FLAG-CD59
(Plasmid
#50377)
-
PurposeExpress Venus and FLAG-tagged human CD59, a GPI-AP in mammalian cells
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 50377 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepME-puro-FLAG-CD59
- Backbone size w/o insert (bp) 5500
- Total vector size (bp) 6200
-
Modifications to backboneVenus was amplified by PCR from pBS7 (Yeast Resource Center) using upper and lower primers both containing SbfI sites and integrated into the pME-puro-FLAG-CD59 plasmid at the SbfI site.
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameVenus
-
Alt nameVenus-FLAG-CD59
-
SpeciesSynthetic
-
Insert Size (bp)700
- Promoter SR alpha
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SbfI (not destroyed)
- 3′ cloning site SbfI (not destroyed)
- 5′ sequencing primer agtaaaggagaagaacttttc
- 3′ sequencing primer tttgtatagttcatccatgcc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please click View Sequences link for full plasmid sequence of vector backbone pME-puro-FLAG-CD59.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pME-puro-Venus-FLAG-CD59 was a gift from Reika Watanabe (Addgene plasmid # 50377 ; http://n2t.net/addgene:50377 ; RRID:Addgene_50377) -
For your References section:
Exit of GPI-anchored proteins from the ER differs in yeast and mammalian cells. Rivier AS, Castillon GA, Michon L, Fukasawa M, Romanova-Michaelides M, Jaensch N, Hanada K, Watanabe R. Traffic. 2010 Aug;11(8):1017-33. doi: 10.1111/j.1600-0854.2010.01081.x. Epub 2010 May 11. 10.1111/j.1600-0854.2010.01081.x PubMed 20477992