pCVL TLR 3.1 (Sce target) Ef1a iRFP Puro
(Plasmid #50417)

• Purpose: Fluorescent reporter for DNA cleavage/repair in mammalian cells expressing iRFP with selectable puromycin marker.
• Depositing Lab: Andrew Scharenberg
• Publication: TLR plasmids (unpublished)

Backbone

• Vector backbone: pCVL.Active/Repressed TLR (Sce)
• Modifications to backbone: Cloned sequence encoding puromycin between NsiI and KpnI from TLR 2.1.
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: eGFP with I-Sce I TS
• Species: H. sapiens (human)
• Insert Size (bp): 759
• Mutation: embedded I-Sce I TS from 163-185
• Promoter: SFFV
• Tags / Fusion Proteins:
  • iRFP (N terminal on backbone)
  • T2A dislinker (N terminal on backbone)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: NsiI (not destroyed)
• 3′ cloning site: KpnI (not destroyed)
• 5′ sequencing primer: CAACGTCAACATCAAGTTG
• 3′ sequencing primer: GGGCCACAACTCCTCATAAA

Gene/Insert 2

• Gene/Insert name: +3 mCherry
• Insert Size (bp): 708

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Note that the only difference between this lasmid and Plasmid #45575 is that there is a Puromycin selection marker