pTrc-trGPPS(CO)-LS
(Plasmid #50603)

• Purpose: pTrc-trGPPS(CO)-LS: A plasmid that has truncated codon optimized geranylpyrophosphate synthase and truncated limonene synthase
• Depositing Lab: Jay Keasling
• Publication: Alonso-Gutierrez et al Metab Eng. 2013 May 29;19C:33-41. doi: 10.1016/j.ymben.2013.05.004.

Backbone

• Vector backbone: E. coli DH10B
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH10B
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: Limonene Synthase
• Insert Size (bp): 1634
• Mutation: truncated codon optimized geranylpyrophosphate synthase
• Promoter: Trc

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: GTCAGAATTAACCCGGGGA
• 3′ sequencing primer: CCTGCAGGTCGACTCACTC

Gene/Insert 2

• Gene/Insert name: ApR
• Insert Size (bp): 860
• Promoter: Trc

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: ATTTGAACGTTGCGAAGCA
• 3′ sequencing primer: TTTGCAAGCAGCAGATTACG

Gene/Insert 3

• Gene/Insert name: LacIq
• Insert Size (bp): 1186
• Promoter: Trc

Cloning Information for Gene/Insert 3

• Cloning method: Unknown
• 5′ sequencing primer: GAGTCAGTGAGCGAGGAAGC
• 3′ sequencing primer: NA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry