Skip to main content
Holiday Schedule: Addgene will be closed November 26th & 27th for the Thanksgiving Holiday. Order processing and shipping may be delayed during this week. For questions about your shipment please contact [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

BNLS
(Plasmid #50836)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 50836 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone size w/o insert (bp) 5500
  • Total vector size (bp) 6280
  • Modifications to backbone
    Multi cloning sites has been replaced by a customized sequence, which is compatible to the reading frame of vector pBAD hisB.
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH10B
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ddGFP B
  • Alt name
    dimerization dependent green fluorescent protein (ddGFP) dark copy
  • Species
    Synthetic; synthetic construct
  • Insert Size (bp)
    787
  • GenBank ID
    KF976775
  • Promoter CMV
  • Tag / Fusion Protein
    • triplicated NLS sequence DPKKKRKV (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (unknown if destroyed)
  • 3′ cloning site HindIII (unknown if destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    BNLS was a gift from Robert Campbell (Addgene plasmid # 50836 ; http://n2t.net/addgene:50836 ; RRID:Addgene_50836)
  • For your References section:

    Ratiometric biosensors based on dimerization-dependent fluorescent protein exchange. Ding Y, Li J, Enterina JR, Shen Y, Zhang I, Tewson PH, Mo GC, Zhang J, Quinn AM, Hughes TE, Maysinger D, Alford SC, Zhang Y, Campbell RE. Nat Methods. 2015 Jan 26. doi: 10.1038/nmeth.3261. 10.1038/nmeth.3261 PubMed 25622108