AAV-EF1a-DIO-ChIEF(E162A/T198C)-P2A-dTomato-WPRE-BGHpA
(Plasmid
#51095)
-
PurposeCre dependent expression of ChIEF kinetic variant E162A/T198C with physically uncoupled dTomato fluorophore
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 51095 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV-EF1a-DIO-WPRE-BGHpA
-
Backbone manufacturercustom
- Backbone size w/o insert (bp) 1047
- Total vector size (bp) 7137
-
Modifications to backboneAltered cloning sites and replaced HGHpA with smaller BGHpA
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameChIEF(E162A/T198C)
-
Alt nameChIEFac
-
SpeciesSynthetic
-
Insert Size (bp)1085
-
MutationE162A/T198C
- Promoter EF1a
-
Tag
/ Fusion Protein
- P2A-dTomato (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HpaI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer gccagcttggcacttgatgtaattctcc
- 3′ sequencing primer CCATACGGGAAGCAATAGCATG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe original ChIEF portion was obtained from Roger Tsien (UCSD/HHMI) through 3rd party Ed Boyden (MIT). The Boyden construct containing ChIEF has a 10 aa truncation at the C terminus of ChIEF compared to the original ref sequence but was tested and confirmed as functional in the Boyden lab.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The addition of the E162A and T198C mutations in ChIEF impart higher photocurrent amplitude while retaining fast kinetic properties. This variant is proposed as an alternative to ChETA variants that exhibit smaller photocurrents and more toxicity.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-EF1a-DIO-ChIEF(E162A/T198C)-P2A-dTomato-WPRE-BGHpA was a gift from Jonathan Ting (Addgene plasmid # 51095 ; http://n2t.net/addgene:51095 ; RRID:Addgene_51095)