AAV-EF1a-DIO-ChIEF(E162A/T198C)-P2A-dTomato-WPRE-BGHpA
(Plasmid #51095)

• Purpose: Cre dependent expression of ChIEF kinetic variant E162A/T198C with physically uncoupled dTomato fluorophore
• Depositing Lab: Jonathan Ting
• Publication: ChIEF and oChIEF AAV vectors (unpublished)

Backbone

• Vector backbone: pAAV-EF1a-DIO-WPRE-BGHpA
• Backbone manufacturer: custom
• Backbone size w/o insert (bp): 1047
• Total vector size (bp): 7137
• Modifications to backbone: Altered cloning sites and replaced HGHpA with smaller BGHpA
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ChIEF(E162A/T198C)
• Alt name: ChIEFac
• Species: Synthetic
• Insert Size (bp): 1085
• Mutation: E162A/T198C
• Promoter: EF1a
• Tag / Fusion Protein:
  • P2A-dTomato (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HpaI (not destroyed)
• 3′ cloning site: NheI (not destroyed)
• 5′ sequencing primer: gccagcttggcacttgatgtaattctcc
• 3′ sequencing primer: CCATACGGGAAGCAATAGCATG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The original ChIEF portion was obtained from Roger Tsien (UCSD/HHMI) through 3rd party Ed Boyden (MIT). The Boyden construct containing ChIEF has a 10 aa truncation at the C terminus of ChIEF compared to the original ref sequence but was tested and confirmed as functional in the Boyden lab.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The addition of the E162A and T198C mutations in ChIEF impart higher photocurrent amplitude while retaining fast kinetic properties. This variant is proposed as an alternative to ChETA variants that exhibit smaller photocurrents and more toxicity.