Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

HO-pMET-poly-KanMX4-HO
(Plasmid #51665)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 51665 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    HO-Poly-HO
  • Backbone manufacturer
    Stillman Lab, Addgene plasmid # 51661
  • Vector type
    Yeast Expression ; yeast integration
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer pHIS-F (in MET17 promoter), TCGTGTAATACAGGGTCGTCA
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    HO-pMET-poly-KanMX4-HO was a gift from David Stillman (Addgene plasmid # 51665 ; http://n2t.net/addgene:51665 ; RRID:Addgene_51665)
  • For your References section:

    Yeast vectors for integration at the HO locus. Voth WP, Richards JD, Shaw JM, Stillman DJ. Nucleic Acids Res. 2001 Jun 15;29(12):E59-9. 10.1093/nar/29.12.e59 PubMed 11410682