Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #51732)


Item Catalog # Description Quantity Price (USD)
Plasmid 51732 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 4600
  • Total vector size (bp) 5644

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
    multiple cloning site
  • Insert Size (bp)
  • Promoter SV40

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site NcoI (not destroyed)
  • 5′ sequencing primer AGGACTGACCGGCAAGTTGG
  • 3′ sequencing primer TGAAGGAGTCCAGCACGTTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    R5 MCS was a gift from Vincent Mauro (Addgene plasmid # 51732 ; ; RRID:Addgene_51732)
  • For your References section:

    Analysis of rRNA processing and translation in mammalian cells using a synthetic 18S rRNA expression system. Burman LG, Mauro VP. Nucleic Acids Res. 2012 Sep;40(16):8085-98. doi: 10.1093/nar/gks530. Epub 2012 Jun 20. 10.1093/nar/gks530 PubMed 22718970