This website uses cookies to ensure you get the best experience. By continuing the use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

cyclin B1-CDK1 FRET biosensor
(Plasmid #52097)


Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 52097 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 5500
  • Total vector size (bp) 7500
  • Modifications to backbone
    Kozac sequence has been added before insert gene and XhoI restriction site. The reading frame of XhoI site has also been modified.
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    CDK1 biosensor
  • Alt name
  • Species
    Synthetic; synthetic construct
  • Insert Size (bp)
  • GenBank ID
  • Promoter CMV
  • Tag / Fusion Protein
    • Kozac sequence (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Please note that Addgene's quality control sequence shows that there is a Q to M mutation in the sensor. The mutations should not affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    cyclin B1-CDK1 FRET biosensor was a gift from Robert Campbell (Addgene plasmid # 52097)
  • For your References section:

    Optimization of a genetically encoded biosensor for cyclin B1-cyclin dependent kinase 1. Belal AS, Sell BR, Hoi H, Davidson MW, Campbell RE. Mol Biosyst. 2014 Feb;10(2):191-5. doi: 10.1039/c3mb70402e. 10.1039/c3mb70402e PubMed 24281384