Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

HBT-pcoCas9
(Plasmid #52254)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 52254 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    HBT-FLAG
  • Vector type
    CRISPR ; plant expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    pcoCas9
  • Alt name
    plant codon–optimized Cas9
  • Species
    Synthetic
  • GenBank ID
    KF264451
  • Promoter hybrid constitutive promoter 35SPPDK
  • Tags / Fusion Proteins
    • FLAG (N terminal on insert)
    • NLS (N terminal on insert)
    • NLS (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site PstI (not destroyed)
  • 5′ sequencing primer sequencing from the promoter: 5’ gtcacgtagtaagcagctctcgg 3’
  • 3′ sequencing primer sequencing from the terminator: 5’ atcgcaagaccggcaacagga 3’
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    HBT-pcoCas9 was a gift from Jen Sheen (Addgene plasmid # 52254 ; http://n2t.net/addgene:52254 ; RRID:Addgene_52254)
  • For your References section:

    Multiplex and homologous recombination-mediated genome editing in Arabidopsis and Nicotiana benthamiana using guide RNA and Cas9. Li JF, Norville JE, Aach J, McCormack M, Zhang D, Bush J, Church GM, Sheen J. Nat Biotechnol. 2013 Aug;31(8):688-91. doi: 10.1038/nbt.2654. 10.1038/nbt.2654 PubMed 23929339