Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pSC-PreE2
(Plasmid #52264)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 52264 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pTXB3
  • Backbone manufacturer
    New England Biolabs
  • Backbone size w/o insert (bp) 6707
  • Total vector size (bp) 7083
  • Modifications to backbone
    GyrA-intein and CBD domain replaced by expression unit with the PreScission cleavage site fused to Ubc9 and GST
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    In combination with a second vector for protein expression in BL21(DE3) cells, the selection pressure was reduced by half to 50 mg/L Ampicillin
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Ubc9 GST fusion
  • Alt name
    Ube2l
  • Alt name
    Ubc9
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1773
  • GenBank ID
    NM_003336.1
  • Entrez Gene
    UBE2I (a.k.a. C358B7.1, P18, UBC9)
  • Tag / Fusion Protein
    • GST (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site BglII (destroyed during cloning)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TGCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Ubc9 cDNAs was amplified from pGEX-based expression vector kindly gifted by Ronald Hay

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSC-PreE2 was a gift from Primo Schaer (Addgene plasmid # 52264 ; http://n2t.net/addgene:52264 ; RRID:Addgene_52264)
  • For your References section:

    Versatile Recombinant SUMOylation System for the Production of SUMO-Modified Protein. Weber AR, Schuermann D, Schar P. PLoS One. 2014 Jul 9;9(7):e102157. doi: 10.1371/journal.pone.0102157. eCollection 2014. 10.1371/journal.pone.0102157 PubMed 25007328