-
PurposeEncode YTHDF2 isoform 2 with N-terminal GST tag for E. coli expression
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 52301 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGEx-4T-1
- Backbone size w/o insert (bp) 4969
- Total vector size (bp) 6538
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsFor protein expression, please use BL21 and 16 C.
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameYTHDF2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1590
-
GenBank IDNM_001172828
-
Entrez GeneYTHDF2 (a.k.a. CAHL, DF2, HGRG8, NY-REN-2)
- Promoter tac
-
Tag
/ Fusion Protein
- GST (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer 5' GGGCTGGCAAGCCACGTTTGGTG 3'
- 3′ sequencing primer 5' CCGGGAGCTGCATGTGTCAGAGG 3' (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEx-4T-1-YTHDF2 was a gift from Chuan He (Addgene plasmid # 52301 ; http://n2t.net/addgene:52301 ; RRID:Addgene_52301) -
For your References section:
N6-methyladenosine-dependent regulation of messenger RNA stability. Wang X, Lu Z, Gomez A, Hon GC, Yue Y, Han D, Fu Y, Parisien M, Dai Q, Jia G, Ren B, Pan T, He C. Nature. 2014 Jan 2;505(7481):117-20. doi: 10.1038/nature12730. Epub 2013 Nov 27. 10.1038/nature12730 PubMed 24284625