pNtCp-rbcL-PHLS-GPPS-aadA-accD
(Plasmid
#52471)
-
PurposeInserts the beta-phellandrene synthase gene, the geranyl diphosphate synthase gene, and aadA resistance in the rbcL-accD intergenic region in Nicociana tabacum
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 52471 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBluescript II KS+
-
Backbone manufacturerStratagene/GE Health
- Backbone size w/o insert (bp) 2886
- Total vector size (bp) 9715
-
Vector typeBacterial Expression, Synthetic Biology
-
Selectable markersSpectinomycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namerbcL-PHLS-GPPS-aadA-accD
-
SpeciesNicotiana tabacum
-
Insert Size (bp)6829
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer GCCAGGGTTTTCCCAGTCACGA
- 3′ sequencing primer GAGCGGATAACAATTTCACACAGG (Common Sequencing Primers)
Resource Information
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNtCp-rbcL-PHLS-GPPS-aadA-accD was a gift from Anastasios Melis (Addgene plasmid # 52471 ; http://n2t.net/addgene:52471 ; RRID:Addgene_52471)